Introduction
Proanthcocyanins
(PAs) are a type of flavonoids formed by the polymerization of flavanone-3-ol
units with C6-C3-C6 basic framework in plant, which are also known as condensed
tannins. Based on the difference of C6-C3-C6 basic framework in polymerization
degree, PAs is divided into monomers, oligomers (n = 2~5) and polymers (n ≥
6) (Monagas
et al. 2005). The degree of PA polymerization is closely related to
fruit quality, such
as the PA of tetramer begin to have bitter and astringent taste in fruit.
With the increase of polymerization degree, astringency is also aggravated. PAs fulfils numerous
functions, including protecting against microbial pathogens, insect pests, larger herbivores (Dixon
et al. 2004) and affecting the flavor and storage quality of red wine (Cosme et al. 2009). PAs is also health beneficial in
the human diet to lower the risk of chronic diseases.
The PAs biosynthesis pathways and its regulation have
been basically clear through the study of model plants, such as Arabidopsis and Alfalfa. Early
biosynthetic genes (EBGs) and late biosynthetic genes (LBGs) constitute PAs biosynthesis (Pelletier et al. 1999; Lepiniec et al. 2006). Chalcone synthase (CHS), chalcone isomerase (CHI), flavonol 3-hydroxylase
(F3H) and flavonol 3′-hydroxylase (F3′H)
belong to the EBGs, which participate in precursor biosynthesis for the whole flavonoid biosynthetic pathway. In the LBGs, dihydroflavonol-4-reductase (DFR), leucoanthocyanidin reductase (LAR),
anthocyanidin synthase (ANS), anthocyanidin reductase (ANR),
TT19 (glutathione S-transferase) ,
TT12 (MATE transporter) and AHA10 (H+-ATPase) are involved in PAs precursor
synthesis as well as PAs compartmetalization, transport, oxidation and
modification (Appelhagen et al. 2015). Among the LBGs, ANR
and LAR, PAs meatabolic specific enzyme, could
convert leuco anthocyanidins to flavane 3-alcohols, such as catechin (C),
gallocatechin (GC), epicatechin (EC) and epigallocatechin (EGC). The next
polymerization mechanism of PAs is still to be confirmed.
There are two general assumptions: (1) EC and EGC might be
catalyzed by the action of flavane-3-alcohol gall acyltransferase to form
flavan 3-O-gallate; (2) Under the effect of plant laccase-like polyphenol
oxidase, such as TT10, EC and EGC is condensed to form polyproanthcocyanins in
the vacuoles (Zhao et al. 2010). At present, it is generally accepted
that the synthesis of anthocyanin and proanthocyanidins is carried out on the
cytoplasmic side of endoplasmic reticulum (ER). However, anthocyanin and PAs
are widely distributed in cytosol, vacuole, ER, chloroplast, nucleus, small
vesicles, apoplastic space, rhizosphere and pollen surfaces, but most of them
are stored in vacuoles. How do these metabolites were transported to vacuoles
and stored in vacuoles to polymerization, and even secreted to the surface of
pollen grains through vacuole membranes and plasma membranes, and then
polymerized has not been studied in depth.
Of all the proteins found that may be involved in the
transport/polymerization process, Arabidopsis
Transparent Testa 10 (TT10) has
attracted the considerable interest from researchers. TT10 encodes a laccasel-like polyphenol oxidase which is identified
from Arabidopsis seed coat color
mutant (transparent seed coat). This protein was secreted to the extraplastid
side under the guidance of the front end signal
peptide, and may convert colorless, soluble PAs or PAs monomer derivatives into
polyproanthcocyanins. Next, the polyproanthcocyanins combines with cell wall
proteins to form insoluble substances deposited in seed coat, thus showing the
special color of seeds at maturity (Pourcel et al.
2005). There is very limited research about TT10
in non-model plant. Recent research showed that silencing of BnTT10 delayed
the pigment accumulation of seed coat at the mature stage, and also increased
soluble PAs levels in the seed coat by more than three times as much as that in
the control. Interestingly, the insoluble PAs content increased by 1.2–1.9
times and the lignin content decreased significantly (Zhang et al. 2013).
It is speculated that BnTT10 is
involved in the synthesis of proanthocyanidins and lignin. In addition,
transforming DkLAC1 gene into
the TT10 mutant of Arabidopsis
thaliana could partially or completely restore its phenotype (Hu et al. 2013), which indicated that DkLAC1 also participated in the
oxidative polymerization of proanthocyanidins.
Strawberry (Fragaria
x ananassa Duch.) is a good source of
flavonoids, such as anthocyanins, flavan-3-ols, flavonols and simple phenols (Pérez
et al. 1997; Lin-Wang et al.
2014). An integrated study at biochemical and molecular level have been
conducted on different developmental stages (Kosar et al. 2004; Almeida et al.
2007) and various strawberry genotypes (Wang and Lewers 2007; Carbone et al. 2009) However, little is known
about the transportation, polymerization and storage process of these compounds
in strawberry fruits. Considering the important
role of flavonoids in the
nutritional quality of strawberry,
we aimed at functionally characterizing the
actual role of FaTT10 in PAs oxidation/polymerization, in hoping to provide
a promising gene candidate for manipulating strawberry flavonoids biosynthesis
and PAs
polymerization.
Materials and Methods
Plant material
Strawberry
(Fragaria × ananassa cv. Benihoppe)
plants were grown in plastic
greenhouse in Chengdu, China. According to the method of Jia et al. (2013), strawberry fruit
development and ripening stages were classified in small green (SG), large
green (LG), de-greening stage (DG), white (WT), initial red (IR), partial red
(PR) and full red (FR), seven developmental stages. At each stage, ten fruits were
collected and snap-frozen in liquid nitrogen, and then were quickly stored at
-80°C until processed. Three independent biological replicates were in this
experiment.
Phylogenetic analysis
GDR (https://www.rosaceae.org/) and TAIR (https://www.arabidopsis.org/)
were used to download protein sequences. Homologues of TT10 genes were
identified by using BioEdit. Phylogenetic relationships of the FaTT10 related proteins were
constructed with the neighbor-joining statistical methods and the
bootstrap method (1000 replications) using the MEGA 7 program.
RNA extraction and cDNA synthesis
An RNA
extraction kit (TaKaRa) was used for the total RNA extraction. RNA sample integrity
and concentration were checked by using an Agilent 2100 bioanalyzer and a
NanoDrop ND-1000 spectrophotometer. Before generating the first cDNA, the
genomic DNA was eliminated, and then cDNA was synthesized using PrimeScript RT Reagent Kit (Takara, Dalian, China)
following the
manufacturer’s protocol. PCR was performed at 37°C for 15 min, followed by 85°C
for 3 sec, and then 12°C for 15 min.
Plasmid construction
A 650 bp cDNAs
fragment specifically targeting FaTT10 gene was amplified using appropriate primers (sense: 5′-CGGGATCCGTCACCATTCATTGGCACGGAGT-3′,
antisense 5′-
CGGAATTCCAGCGTAAGCAGAGGAAGCCAT-3′) cloned into the BAMH І and EcoR І
sites of pTRV2. Then,
pTRV1, pTRV2, and pTRV2 derivatives pTRV2-TT10 were separately
transformed into Agrobacterium strain
GV3101 for RNAi. For overexpression of FaTT10 gene, a 1719 bp cDNAs fragment of FaTT10 was amplified
using specific primers (FaTT10: sense 5′-TGCTCTAGAATGGCTGGGTTTAACAAAATGGGAG-3′,
and antisense 5′-CGGGATCCCTAAGACTTGGAGCAAGGAGGCAT-3’) cloned into the BAMH І and Xba І sites of pCAMBIA1301. Then pCAMBIA1301, or pCAMBIA1301
derivatives pCAMBIA1301- TT10 was transformed into Agrobacterium strain GV3101 for overexpression. Agrobacterium-mediated virus
infiltration into strawberry fruits was performed based on the method of Jia et al. (2011). The Agrobacterium suspension was infiltrated into every DG fruit, and
then the injected fruit was placed in a growth chamber at 23°C under 16 h light/8
h dark and 80~90% relative humidity for 6 days. During this period, the above
injection was repeated twice at the next day and the third day after the first
infiltration. Each treatment had ten uniformly sized fruit, and with three
replicates.
Quantitative real-time PCR
(qRT-PCR) analysis
The qRT-PCR was used to analyse the expression level of FaTT10 gene and
structural genes of PA biosynthesis pathway in the FaTT10-overexpression, FaTT10-RNAi and control fruit. The specific qRT-PCR primers
designed for structural genes were following: L-phenylalanine ammonia-lyase (PAL, sense, 5’- CTCGGTCCACTAATTGAAG-3’; antisense, 5’- AATGCCTTGTTCCTTGAA-3’ ); Cinnamate 4-hydroxylase (C4H, sense, 5’-
TGCCCTTGGCTTCATGACT-3’; antisense, 5’-
GCTTGACACTACGGAGAAAGGT-3’); 4-coumarate:CoA
ligase (4CL, sense, 5’-ACAAGACAATCACGAGTTCA-3’;
antisense, 5’- AGCAGTAGGTGTGGAGAG-3’); chalcone synthase (CHS sense, 5’- CAAGCCTGAGAAGTTAGAAG-3’; antisense, 5’- AAACAACACACAAGCACTA -3’); chalcone isomerase (CHI, sense, 5’-
CAAGCCTGAGAAGTTAGAAG-3’; antisense, 5’-AAACAACACACAAGCACTA-3’); flavanone 3-hydroxylase (F3H, sense, 5’-
ATCACCGTTCAACCTGTGGAAG-3’; antisense, 5’-
TCTGGAATGTGGCTATGGACAAC-3’); dihydroflavonol
reductase (DFR, sense, 5’-
GCTACATCTGTTCATCAC-3’; antisense, 5’-GTCAAGTTCTCCTCAATG-3’); anthocyanin reductase (ANR, sense, 5’-CCTGAATACAAAGTCCCGACTGAG-3’;
antisense, 5’-
GTACTTGAAAGTGAACCCCTCCTTC-3’); anthocyanin
synthase (ANS, sense, 5’-GCTGCTCTCATCTCAACTAA-3’;
antisense, 5’- CCTGCTCAACATCGTCTT -3); lecoanthocyanidins reductase (LAR, sense, 5’-
GGTGATGGCACGGTTAAAGC-3’; antisense, 5’-
CTCCCACAGTGAAGCAAGTCC -3’); and Actin (sense, 5’-TTCACGAGACCACCTATAACTC-3’;
antisense, 5’- GCTCATCCTATCAGCGATT
-3’). qRT-PCR procedures was: holding for 3 min at 95°C, followed by 40 cycles for 10
s at 95°C, annealing for 30 s at 55°C and 72°C for 15 s. Relative fold changes
in gene expression were analyzed using the 2 − ∆∆CT
method.
4-dimethylaminocinamaldehyde
(DMACA) staining assay
DMACA
staining method was used for the observation of PAs accumulation patterns in FaTT10 RNAi and overexpression fruit (Li
et al. 1996). Longitudinal sections of fruits about 0.2 cm thick were
soaked and decolorized in ethanol solution (3:1, v/v) and glacial acetic acid
for 12–20 h, and rinsed with 75% ethanol for12 h, then rinsed with distilled
water. After dyeing with 0.6% (w/v) DMACA solution in a cold mixture of
methanol and 6 M HCL (1:1, v/v) for 2 min, photographic records were taken.
Determination of PAs monomer and anthocyanin
content
PAs
monomer content was determined by using the PAs determination kit (Shagnhai
MLBIO Biotechnology Co., Ltd. and Suzhou Keming Biotechnology Co., Ltd.). The
quantification of total anthocyanin was measured by the pH differential spectrophotometry
method (Cheng and Breen 1991). Briefly, the extraction was conducted from 0.5 g
mixed strawberry fruit homogenized with 1.8 mL of cold 1% HCl-ethanol. Then,
the homogenate was centrifuged at 8, 000 × g
for 25 min at 4°C. Next, the supernatants were collected for determination of
the total anthocyanin content. Anthocyanin concentration was expressed as mg
pelargonidin 3-glucoside equivalents 100 g-1 of fresh weight.
Confocal microscopy
Full
coding sequence of the FaTT10 was amplified with primer subc-TT10-F and
subc-TT10-R. The open reading frame was then fused to the N-Terminal of the GFP
marker in a modified pC1302-35S-GFP vector after Nco I and Spe I digestion. The
correct construct was subsequently transformed into the Agrobacterium
tumefaciens strain GV3101 and transiently expressed in Nicotiana
benthamiana leaves epidermal cell. Stains with the marker (ABRC stock
CD3-1003) were used as positive and reference control. GFP signals were
captured by Nikon A1 Confocal Laser Microscope.
%201222-1230_files/image002.png)
Fig. 1: Phylogenetic analyses of FaTT10 and its closest relatives.
Phylogenetic analysis was performed by a neighbor-joining algorithm using MEGA
7 program. Gene IDs were listed as: Prunus persica PpTT10 XP_007200191,
Prunus dulcis PrTT10 VVA36043, Prunus mume
PmTT10 XP_008237408, Malus domestica MdTT10 XP_028965267, Pyrus bretschneideri PbTT10 XP_009351840, Fragaria vesca FvTT10 XP_011464921, Citrus sinensis CsTT10
XP_006473165, Vitis vinifera VvTT10 XP_002272689, Gossypium hirsutum GhTT10 XP_016748740, Arabidopsis thaliana AtTT10
NC_003076, Brassica napus BnTT10a ADV03954, Brassica
napus BnTT10b ADV03952, Brassica rapa BrTT10
XP_009129702, Raphanus sativus RsTT10 XP_018435646.1, Tarenaya hassleriana ThTT10 XP_010521293, Medicago
truncatula MtTT10 XP_003603035, Rosa chinensis
RcTT10 XP_024189647, Eucalyptus grandis EgTT10 XP_010031937, Nicotiana
attenuata NaTT10 XP_019264267, Nymphaea colorata NcTT10 XP_031502939
Results
Phylogenetic
tree of TT10-like homologues for strawberry
To further identify the characteristics of FaTT10,
a neighbor-joining phylogenetic tree was constructed with 1000 bootstrap
replicates. Scale bars indicate 0.05 estimated amino acid substitutions per site.
Numbers above branches indicate the
reliability of the associated taxa clustering. The phylogenetic tree showed FaTT10 is
more closely related to Fragaria vesca than
Pyrus bretschneideri, but clearly distant
from that Arabidopsis
(Fig. 1).
Changes
of PAs monomer content during strawberry fruit development
PAs
monomer content was measured during strawberry fruit development. The results
showed that the PAs monomer content was mainly accumulating at early and late
stage during fruit development. The lowest PA monomer was observed at WT stage,
which was 6.56 mg 100 g-1 FW, and then followed by a gradual
increase and reached a highest value at FR stage, which was 71 mg 100 g-1
FW and increased by 10.83 fold compared with that of the
fruit at WT stage (Fig. 2).
Silencing
of the FaTT10 promoting the accumulation of proanthocyanidins
monomer
To test the role of FaTT10 in PAs polymerization, FaTT10 was knocked down by RNAi. Thirty fruits with pedicel were injected with the
FaTT10-RNAi vector in vitro. Six days after infiltration, the
phenotypic changes of the control and RNAi fruits were observed. The fruit
phenotype showed that strawberry fruits grew normally, and there were no
adverse symptoms such as fruit shrinkage, mold growth and virus infection in vitro, which indicated that the
control and FaTT10-RNAi fruits could
be inoculated with Agrobacterium in vitro and did not affect the
observation of strawberry fruits phenotype after gene silencing. The results
showed that there were more colored fruits in FaTT10-RNAi group than that in control (Fig. 3A, B). Meanwhile, qRT-PCR
results showed that FaTT10 expression
level was significantly down-regulated by 0.54fold in the FaTT10-RNAi fruit compared with the control (Fig. 3C), and the
content of anthocaynin and PAs monomer increased by 3.0fold and 2.81fold,
respectively (Fig. 3D, E).
PAs are colorless before oxidation, and blue products
are produced when they react with DMACA reagents. Therefore, DMACA reagents are
commonly used to stain fresh plant tissues. The distribution and content of PAs
can be determined by the localizaiton and color of blue products. In this
experiment, PAs were located in the control and FaTT10-RNAi fruit tissue and seemed to be more concentrated in the
stele of fruit, followed by the pith, the vascular bundle, and the cortex (Fig.
3F). Furthermore, the blue color of the stele, the pith and the vascular bundle
in control was more concentrated
compared with that of FaTT10-RNAi
fruit, which suggested that silencing FaTT10
gene could inhibit the accumulation of PAs in strawberry fruit. Taken together,
silencing of FaTT10 gene up-regulated
the content of anthocyanin and PAs monomer, which led
to the inhibition of PAs content in strawberry fruit.
Overexpression of FaTT10 inhibiting
the accumulation of proanthocyanidins monomer
To further explore FaTT10 gene
function in PAs
polymerization of strawberry fruit, overexpression FaTT10 via
agro-infiltration was also applied in this study. The control and the TT10-overexpression fruit showed the
similar fruit phenotype on the sixth day after Agrobacterium injection,
which fruit surface was white or partly red (Fig. 4A, B). Meanwhile, qRT-PCR results
demonstrated that the transcriptional level of FaTT10 was significantly up-regulated by 11fold in the FaTT10-overexpression fruit compared
with that of the control fruit (Fig. 4C), which meant that the FaTT10 gene was successfully
overexpressed in the strawberry fruits. Furthermore, almost no anthocaynin was
detected (data not listed), but PAs monomer decreased
by 0.23fold (Fig. 4D). DMACA dyeing showed that the spatial accumulation of PAs
was also in the stele, pith, vascular bundle and cortex of FaTT10-overexpression and control fruit, and concentrated blue
color was mainly observed in the stele, and pith of FaTT10-overexpression fruit compared with that of control fruit
(Fig. 4E). Above all, overexpression FaTT10
gene inhibited the PAs monomer
content, while promoted the accumulation of PAs.
Alteration of FaTT10 genes expression affects the transcripts
of PAs biosynthesis-related genes
%201222-1230_files/image004.png)
Fig. 2: PAs
monomer content during strawberry fruit development. Small green (SG, 7 d after
anthesis), large green (LG, 14 d after anthesis), de-greening (DG, 18 d after
anthesis), white (WT, 20 d after anthesis), initial red (IR, 23 d after
anthesis) and full red (FR, 28 d after anthesis). Values are means ± SD of
three biological replicates. An overall significant difference (P ≤ 0.5) is represented by
different lower-case letters as determined by Duncan’s multiple range test
%201222-1230_files/image006.jpg)
Fig. 3: VIGS for the FaTT10 gene in strawberry fruit. (A) The phenotype of control fruit inoculated with Agrobacterium containing TRV2 in vitro. (B) The phenotype of virus-induced FaTT10 silencing in
strawberry fruits. (C) FaTT10 expression level in the control
and RNAi fruits by qRT-PCR.
(D) PAs
monomer content in the control and FaTT10-RNAi
fruits. (E) Anthocaynin
content in the control and FaTT10-RNAi
fruits. (F) DMACA staining of
longitudinal sections of the control and FaTT10-RNAi
fruits. Values are means ± SD of three biological replicates. An overall
significant difference (P ≤ 0.5)
is represented by different lower-case letters as determined by Duncan’s
multiple range test
%201222-1230_files/image008.jpg)
Fig. 4: Overexpression for the TT10 gene in strawberry fruit. (A) The control fruit phenotype on the 6th day in vitro. (B) The FaTT10
overexpression fruit phenotype on the 6th day in vitro. (C) FaTT10 expression level in the control
and overexpression fruits. (D) PAs monomer content in the control and overexpression
fruits. (E) DMACA staining of
longitudinal sections of the control and overexpression fruits. Values are
means ± SD of three biological replicates. An overall significant difference
(P≤0.5) is represented by different lower-case letters as determined by
Duncan’s multiple range test
%201222-1230_files/image010.png)
Fig. 5: Alteration of FaTT10 expression affects transcripts of
a set of PAs biosynthesis related genes in silencing and overexpressing
fruit. Values are means ± SD of
three biological replicates. (A)
mRNA expression level of PAs biosynthesis relevant genes in RNAi fruit. (B) mRNA expression level of PAs
biosynthesis relevant genes in overexpression fruit
In
order to explore the mechanism of FaTT10 gene
in the regulation of strawberry PAs biosynthesis, a set of genes related to
flavonoids metabolism, such as L-phenylalanine ammonia-lyase (PAL); cinnamate 4-hydroxylase
(C4H); 4-coumarate CoA ligase (4CL); chalcone
synthase (CHS); chalcone isomerase (CHI); flavanone 3-hydroxylase (F3H); dihydroflavonol reductase (DFR); anthocyanin reductase (ANR); anthocyanin synthase (ANS) and lecoanthocyanidins reductase
(LAR), were measured using both overexpression and RNAi fruit. The results showed that there were
significant differences in the expression levels of the above genes between the
RNAi fruit and the control fruit, except ANS gene (Fig. 5A). According
to the
characteristics of genes
expression level, it can be roughly divided into two categories: one is that
the expression level in RNAi-FaTT10 fruit was significant up-regulated
compared with that in control fruit, including PAL, C4H, 4CL,
CHS, CHI and F3H (Fig. 5A). The expression levels of 4CL
were up-regulated by more than twice, PAL and C4H were
up-regulated by about 60%, CHS, CHI and F3H were
up-regulated by 48, 29 and 24%, respectively. Another kind of genes, including DFR,
ANR and LAR, which expression levels were down-regulated by 14,
20 and 19% in RNAi-FaTT10 fruit compared with that in control fruit,
respectively (Fig. 5A).
In addition, the expression level of PAs
biosynthesis related genes was also quantified in FaTT10 overexpression fruit and control fruit.
Among these structural gene of PAs biosynthesis, the expression level of
PAL, C4H, DFR, ANR,
ANS and LAR genes was significant up-regulated in FaTT10 overexpression
fruit compared with that in control fruit, while the expression level of CHI
and F3H genes was significant down-regulated (Fig. 5B). Taken together,
these changes in the expression of genes associated with the %201222-1230_files/image012.png)
biosynthesis of PAs in FaTT10 RNAi and overexpression
strawberry fruit suggested that FaTT10 were involved in the regulation
of PAs biosynthesis by regulating the expression levels of PAs
biosynthesis-related genes.
Sub-celluar
localization of FaTT10
After 36 h infection with
Agrobacterium containing pC1302-35S-GFP::TT10
vector and pC1302-35S-GFP empty
vector respectively, the epidemis of Nicotiana benthamiana
leaves were observed by fluorescence
confocal microscope. The results showed that the GFP signal was mainly detected at
the plasma membrane in cells transfected with the empty vector and in cells expressing
the TT10 fusion proteins (Fig. 6), suggesting that TT10 might be membrane
proteins.
Discussion
Laccase (EC 1.10.3.2) is
ubiquitous in bacteria, fungi, insects and higher plants. The research on fungi
laccase are the most reported, which function is
associated with enhancing virulence of pathogenic bacteria (Salas et al. 1996), lignin degradation (Eggert et al. 1997) and pigment synthesis (Fang et al.
2010). The research on plant laccase is mainly focused on lignin synthesis (Sterjiades et al. 1992; Bao et al. 1993; Ranocha et al. 2002) stress response (Li and Steffens 2002)
and pigment synthesis (Cai et al. 2006). Through our previous
gene cloning, sequence analysis and subcellular localization prediction, it was
showed that the protein encoded by FaTT10 gene belongs to the laccase
family and anchors at plasma membrane (Mo et al. 2019). In this study, sub-celluar localization experiment confirmed TT10 located in the plasma membrane in present study. Phylogenetic analysis strengthened TT10 share common genetic ancestry in Rosacea species because of close evolutionary relationships (Fig. 1). In future work,
it would be interesting to explore the overall evolutionary history of the whole TT10 family from a wider species range.
Strawberry was
identified as potential sources of B-type proanthocyanidins. (Epi) catechin and
(epi) afzelechin was always the terminal unit of proanthocyanidin
oligomers (Gu et al. 2003). Through proanthocyanidin determination of 15
strawberry cultivars in Spain, it was found that the concentration of
proanthocyanidin ranged from 53.9 mg 100 g-1 to 168.1 mg 100 g-1,
which was genotype-dependent and (epi) catechin was the main proanthocyanidin
oligomers in strawberry fruit ( et al. 2010). In the previous study, it has been reported
that decreased PAs coupled with the decreasing FaTT10 expression level
during strawberry fruit development and ripening (Mo et al. 2019), while the content of PAs monomers decreased gradually in fruit
from SG to WT stage and then followed by a gradual increased from WT to FR
stage (Fig. 2). The simplest hypothesis for this is that FaTT10 specifically
regulates the content of PAs monomers could be an integrate part
of regulation mechanism for oxidative polymerization of PAs.
In present study, our
results showed that inhibition of FaTT10 genes results in more colored fruit (Fig. 3B) and an increase in the level of anthocyanin and PAs monomer (Fig. 3D)
in strawberry fruit.
In contrast, overexpression of FaTT10 genes can decrease the accumulation of PAs monomer (Fig. 3D). Similar results were obtained in Brassica napus and Arabidopsis, showing that the content of soluble PAs in AtTT10
mutant seeds (Pourcel et al. 2005) and BnTT10-RNAi
seeds (Zhang et al. 2013) was higher than that in wild type. In
addition, DMACA staining results also showed that lighter blue color in the FaTT10-RNAi fruit (Fig. 3F) and
concentrated blue color in the FaTT10-overexpression
fruit (Fig. 3E) were observed. In Chinese PCNA persimmon, the concentrated blue
color was observed in overexpression DkLAC1 leaves by DMACA staining, as
well as the increased soluble and insoluble PA (Mo 2015).
The end products of the flavonoid biosynthetic
pathway are PAs. Various MYB–bHLH–WDR (MBW) protein complexes and
flavonoid synthesis structure gene (ANR, LAR and ANS) (Feng et al. 2013; Xiao et al.
2014) are involved
in the regulation of PAs synthesis at the transcriptional level (Xu et al. 2014a; Xu et al. 2015). In present study,
alternation of FaTT10 expression
level affected the flavonoid
biosynthetic pathway, which includes up-regulation of PAL, C4H,
DFR, ANR, ANS and LAR expression level (Fig. 5B) in FaTT10-overexpression fruit, and down-regulation of LBGs (DFR, ANR
and LAR) transcriptional level (Fig.
5A) in FaTT10-RNAi fruit compared with respective control. In note, down-regulation
of DFR, ANR and LAR was also observed during strawberry fruit
development (Xu et al. 2014b).
Conclusion
In this study, PAs monomer contents first decreased and then increased gradually during
strawberry fruit development and ripening. Transient knock-down of FaTT10 or overexpression increased or decreased the level of
PAs monomer, accompanied by the
changes in PAs contents and gene expression on flavonoids synthesis pathway.
The above results indicate that FaTT10 contributes to proanthocyanins polymerization.
Acknowledgements
This study was supported by the National Natural Science
Foundation of China (3180817); the State Education Ministry, Key projects of
Sichuan Provincial Education Department (172A0319) and Key projects of Sichuan
Provincial Science and Technology Department (2018NZ0126) and
Service Station Projects of New Rural Development Research Institute, Sichuan
Agricultural University (2018, 2020).
Author
Contributions
Ya Luo was responsible for the design of the
experiments and the main writing of the manuscript. Most of the experiments and
data analysis was completed by Gouyan Hou and Min Yang. All authors participated
in the discussion of the results and comments on the manuscript.
Conflict of Interest
All the
authors declare no conflict of interest.
Data Availability
All data
included in this study are available upon request by contact with the
corresponding author.
Ethics Approval
This article
does not contain any studies with human participants or animals performed by
any of the authors.
References
Almeida JRM, ED’Amico, A Preuss, F Carbone. CHR Vos, B Deiml, F Mourgues, G Perrotta, TC Fischer, AG Bovy, S Martens, C Rosati (2007). Characterization of major enzymes and genes
involved in flavonoid and proanthocyanidin biosynthesis during fruit
development in strawberry (Fragaria × ananassa). Arch Biochem Biophys 465:6171–6181
Appelhagen
I, N Nordholt, T Seide, K Spelt, R Koes, F Quattrochio, M Sagasser, B Weisshaar (2015).
TRANSPARENT TESTA 13 is a tonoplast P3A‐ATPase
required for vacuolar deposition of proanthocyanidins in Arabidopsis thaliana seeds. Plant
J 82: 840‒849
Bao W, DM O'malley, R Whetten, RR
Sederoff (1993). A Laccase associated with lignification in Loblolly Pine xylem. Science 260:672‒674
B, HPLC-MS
Analysis of Proanthocyanidin Oligomers and Other Phenolics in 15 Strawberry
Cultivars. J
Agric Food Chem 58:3916‒3926
Cai XN, EJ Davis, J Ballif, MX Liang,
E Bushman, V Haroldsen, J Torabinejad, YJ Wu (2006). Mutant identification and
characterization of the laccase gene family in Arabidopsis. J Exp Bot 57:2563‒2569
Carbone F, A Preuss, RCH Vos, E D'Amico,
G Perrotta, AG Bovy, S Martens, C Rosati (2009). Developmental, genetic and
environmental factors affect the expression of flavonoid genes, enzymes and
metabolites in strawberry fruits. Plant
Cell Environ 32:1117–1131
Cheng GW, PJ Breen (1991).
Activity of phenylalanine ammonia-lyase (PAL) and concentrations of
anthocyanins and phenolics in developing strawberry fruit. J Amer Soc Hortic
Sci 116:865‒869
Cosme F, JM Ricardo-Da-Silva, O Laureano
(2009). Effect of various proteins on different molecular weight
proanthocyanidin fractions of red wine during wine fining. Amer J Enol
Viticult 60:74‒82
Dixon RA, DY Xie, SB Sharma
(2004). Proanthocyanidins – a final frontier in flavonoid research? New Phytol 165:9‒28
Eggert C, U Temp, KEL Eriksson (1997).
Laccase is essential for lignin degradation by the white-rot fungus Pycnoporus cinnabarinu. FEBS Lett
407:89‒92
Fang WG, EKK Fernandes, DW Roberts, MJ Bidochka, RJS
Leger (2010). A laccase exclusively expressed by Metarhizium anisopliae during isotropic growth is involved in
pigmentation, tolerance to abiotic stresses and virulence. Fung Genet Biol 47:602‒607
Feng HJ, XH Tian, YC Liu, YJ Li, XY Zhang, BJ Jones, YQ
Sun, J Sun (2013). Analysis of flavonoids and the flavonoid structural genes in
brown fiber of upland cotton. PLoS One 8; Article e58820
Gu LW, MA Kelm, JF Hammerstone, G
Beecher, J Holden, D Haytowitz, RL Prior (2003). Screening of foods containing
proanthocyanidins and their structural characterization using LC-MS/MS and
thiolytic degradation. J Agric Food Chem 51:7513‒7521
Kosar M, E Kafkas, S Paydas, KHC
Baser (2004). Phenolic composition of strawberry genotypes at different
maturation stages. J Agric Food Chem
52:1586–1589
Lin-Wang K, TK McGhie, M Wang, Y
Liu, B Warren, R Storey, RV Espley, AC Allan (2014). Engineering the
anthocyanin regulatory complex of strawberry (Fragaria vesca). Front Plant
Sci 5; Article 651
Monagas
M, B Hernández-Ledesma, I Garrido, PJ Martín-lvarez, C Gómez-Cordovés, B Bartolomé
(2005). Quality assessment of commercial dietary antioxidant products from Vitis vinifera L. grape seeds. Nutr Cancer 53:244‒254
Pelletier
MK, IE Burbulis, B Winkel-Shirley (1999). Disruption of specific flavonoid genes
enhances the accumulation of flavonoid enzymes and end-products in Arabidopsis seedlings. Plant Mol Biol
40:45‒54
Pérez AG, R Olías, J Espada, JM Olías,
C Sanz (1997). Rapid determination of sugars, nonvolatile acids, and ascorbic
acid in strawberry and other fruits. J Agric Food Chem 45:3545‒3549
Wang SY, KS Lewers (2007).
Antioxidant capacity and flavonoid content in wild strawberries. J Amer Soc Hortic Sci 132:629–637
Xiao YH, Q Yan, H Ding, M Luo, L Hou, M Zhang, D Yao, HS
Liu, X Li, J Zhao, Y Pei (2014). Transcriptome and biochemical analyses
revealed a detailed proanthocyanidin biosynthesis pathway in brown cotton
fiber. PLoS One 9; Article e86344
Xu WJ, C Dubos, L Lepiniec (2015). Transcriptional control
of flavonoid biosynthesis by MYB–bHLH–WDR complexes. Trends Plant Sci 20:176‒185
Xu WJ, L Loïc, D Christian (2014a). New insights toward
the transcriptional engineering of proanthocyanidin biosynthesis. Plant Signal Behav
9; Article e28736
Xu WP, H Peng, TB Yang, B Whitaker, LH Huang, JH Sun, P Chen
(2014b). Effect of calcium on strawberry fruit flavonoid pathway gene
expression and anthocyanin accumulation. Plant
Physiol Biochem 82:289‒298
Zhang K, K
Lu, C Qu, Y Liang, R Wang, Y Chai, JN Li (2013). Gene silencing of BnTT10 Family genes causes retarded
pigmentation and lignin reduction in the seed coat of Brassica napus. PLoS One 8; Article e61247